View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15825_low_22 (Length: 251)
Name: NF15825_low_22
Description: NF15825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15825_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 46302860 - 46302641
Alignment:
| Q |
17 |
attctgaacctgaagagcgacggggtgtcaaatcaagagacacgtat-aaaaaactgtttaaaactacattagttaagaaaatcctaaattaaaaatttc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46302860 |
attctgaacctgaagagcgacggggtgtcaaatcaagagacacatatcaaaaaactgtttaaaactacattagttaagaaaatcctaaattacaaatttt |
46302761 |
T |
 |
| Q |
116 |
ccttttttaagtagagtcaatttaactgatgatgttgatattattaggttggacacacattcaacaacatagttcgaactcgagatttcatggttggatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46302760 |
ccttttttaagtagagtcaatttaactgatgatgttgatattattaggttgga--cacattcaacaacatagttcgaactcgagatttcatggttggatg |
46302663 |
T |
 |
| Q |
216 |
tattggctttagggttgtcact |
237 |
Q |
| |
|
| || ||||||||||||||||| |
|
|
| T |
46302662 |
tgttagctttagggttgtcact |
46302641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University