View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15825_low_32 (Length: 218)
Name: NF15825_low_32
Description: NF15825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15825_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 14 - 199
Target Start/End: Complemental strand, 42336575 - 42336390
Alignment:
| Q |
14 |
ataatactatcaagtataagccttttatcatcacattgcaaccctagcaaacnnnnnnnnnnnncaccttgttttcaattttcaaaatgaatctcaacat |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42336575 |
ataatactatcaagtataagcctttcatcatcacattgcaaccctagcaaacaaaaaagaaaaacaccttgttttcaattttcaaaatgaatctcaacat |
42336476 |
T |
|
| Q |
114 |
tgtgttctctcttgcattcatctgcattgttatcgccggtgtcggaggccagtcgccttcaccggcaccagcccctgctgggtctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
42336475 |
tgtgttctctcttgcattcatctgcattgttatcgccggtgtcgtaggccagtcgccttcaccggcaccagcccccgctggttctt |
42336390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 164
Target Start/End: Original strand, 19792346 - 19792394
Alignment:
| Q |
116 |
tgttctctcttgcattcatctgcattgttatcgccggtgtcggaggcca |
164 |
Q |
| |
|
|||||||| ||||| |||||||||||||| |||||| |||| ||||||| |
|
|
| T |
19792346 |
tgttctcttttgcactcatctgcattgttgtcgccgctgtcagaggcca |
19792394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University