View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15827_low_5 (Length: 287)
Name: NF15827_low_5
Description: NF15827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15827_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 5835265 - 5834997
Alignment:
| Q |
1 |
tcaaattattagtggtgtcggcgtatcattgtctaaatcgtgtctgtgtccatataactctttaccnnnnnnnnnnnnnnnnnnnnnnnnnagtggaagg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5835265 |
tcaaactattagtggtgtcggcgtatcagtgtctaaatcgtgtctgtgtccatataactctttacccttttttctttacacttttttctttagtggaagg |
5835166 |
T |
|
| Q |
101 |
aatctaaggaccaagtatcatgctttcttgctatgagacggttctaagtttgtttttctccaatatacataagannnnnnnnnnnnnnnnctatttaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5835165 |
aatctaaggaccaagtatcatgctttcttgctatgagacggttctaagtttgtttttctccaatatacataaga--ttttttttctttttctatttaatt |
5835068 |
T |
|
| Q |
201 |
ttccaagtatcaattttcaagaatattcctagaagccatttactagtacagaataacaagtacaagcagtg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5835067 |
ttccaagtatcaattttcaagaatattcctagaagccatttactagtacagaataacaagtacaagcagtg |
5834997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University