View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15827_low_6 (Length: 259)
Name: NF15827_low_6
Description: NF15827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15827_low_6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 31935874 - 31935616
Alignment:
| Q |
1 |
gtggagaggatcttaaccggaggtgtccctcggagctgagtgtggacggtggtgacgcgtgtaatagcgcgtgtggtgcgtttgggacaccggagtattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31935874 |
gtggagaggatcttaaccggaggtgtccctcggagctgagagtggacggtggtgacgcgtgtaatagcgcgtgtggcgcgtttgggacaccggagtattg |
31935775 |
T |
|
| Q |
101 |
ttgtagtggcgcgtttggttcgccatcgggttgttcgccttcggtttattcggaaatgtttaaatctgcttgtcctaaatcttatagctatgcgtttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935774 |
ttgtagtggcgcgtttggttcgccatcgagttgttcgccttcggtttattcggaaatgtttaaatctgcttgtcctaaatcttatagctatgcgtttgat |
31935675 |
T |
|
| Q |
201 |
gatgctacgagtacttttacttgtactgctgcggatgattatactatcacattttgtcc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935674 |
gatgctacgagtacttttacttgtactgctgcggatgattatactatcacattttgtcc |
31935616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 56 - 236
Target Start/End: Complemental strand, 27975539 - 27975359
Alignment:
| Q |
56 |
cgcgtgtaatagcgcgtgtggtgcgtttgggacaccggagtattgttgtagtggcgcgtttggttcgccatcgggttgttcgccttcggtttattcggaa |
155 |
Q |
| |
|
||||||||| |||||||||| || ||||| | || |||||||||||||||||||||| |||||| || || |||| || ||| |||| |||||| |
|
|
| T |
27975539 |
cgcgtgtaagagcgcgtgtgaggcttttggtagtcctgagtattgttgtagtggcgcgtatggttcaccggcgacttgtagaccgtcgatttactcggaa |
27975440 |
T |
|
| Q |
156 |
atgtttaaatctgcttgtcctaaatcttatagctatgcgtttgatgatgctacgagtacttttacttgtactgctgcggat |
236 |
Q |
| |
|
||||||||| |||||| |||| ||| |||||||| || | |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27975439 |
atgtttaaaaatgcttgccctagatcgtatagctacgcttatgatgatgcttcgagtacttttacttgtactgctgcggat |
27975359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 57 - 116
Target Start/End: Original strand, 8810723 - 8810782
Alignment:
| Q |
57 |
gcgtgtaatagcgcgtgtggtgcgtttgggacaccggagtattgttgtagtggcgcgttt |
116 |
Q |
| |
|
||||||||||| || ||||| |||||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
8810723 |
gcgtgtaatagtgcttgtggcgcgtttgggaaaccggaatattgttgtaacggcgcgttt |
8810782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University