View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15828_high_10 (Length: 349)
Name: NF15828_high_10
Description: NF15828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15828_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 332
Target Start/End: Original strand, 18921948 - 18922266
Alignment:
| Q |
14 |
caaaggcaaaataaaacaatttactgaaaactgaaagtggaattattgtgcaagatgactaaggctcaaaatcaatgaaggttagtctctgattctt--g |
111 |
Q |
| |
|
|||||| |||||||||||| | ||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
18921948 |
caaaggaaaaataaaacaaataactgaaaactgaaagtggaattattgtgccagatcactaaggctcaaaaccaatgaaggttagtctctgattctctcg |
18922047 |
T |
|
| Q |
112 |
atagtgtcaagtttcactgagtttgcgaccatttgatctatttgaaaagtaagatatctaaggatattccgaggtaaatctatttcggttgaagctattt |
211 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||| ||||||| |||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18922048 |
acagtgtcaagtttcactgagtttgcgagcatttggtctatttaaaaagtaagatacctacggatattccaaggtaaatctatttcggttgaagctattt |
18922147 |
T |
|
| Q |
212 |
tataacagtcaaaaatgtgtttgtggaattggttacatgtgagagcaaacagctgcaattactatacagttcaatggttctcaaatccatgggtgtacct |
311 |
Q |
| |
|
|| |||||||||||| ||| |||||||||||||||| | |||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
18922148 |
tagaacagtcaaaaa--tgtctgtggaattggttacacgcgagagcaaacagcttcaattactatatagttcaatggttctcaaatccatgggcgtacct |
18922245 |
T |
|
| Q |
312 |
tggactcacggggtaatgctt |
332 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
18922246 |
aggactcgtggggtaatgctt |
18922266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University