View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15828_high_11 (Length: 319)
Name: NF15828_high_11
Description: NF15828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15828_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 4961801 - 4962113
Alignment:
| Q |
1 |
tattatttagttataaagactacttgcaaaagctcaatgcaatttgcttctattgtgaaattattgtctctaaagtccgatatagatccaaaagtgttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4961801 |
tattatttagttataaagactacttgcaaaagctcaatgcaatttgcttctattgtgaaattattgtctctaaagtccgatatagatccaaaagtgttgc |
4961900 |
T |
 |
| Q |
101 |
caaaagagacattgattccaatcttagacgttcattctccgttgataatatgagattgtattgcatggttaaccctagctggttttttagttcccggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4961901 |
caaaagagacattgattccaatcttagacgttcattctccgttgataatatgagattgtattgcatggttaaccctagctggttttttagttcccggttt |
4962000 |
T |
 |
| Q |
201 |
tccattctcaaccggttcaaatcgttcgtgaggttctctacgtgccgcttctttctccaacgtgaccgcctagctgactcccggtttgattgcattctcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4962001 |
tccattctcaaccggttcaaatcgttcgtgaggttctctacgtgccgcttctttctccaacgtgaccgcctagctgactcccggtttgattgcattctcc |
4962100 |
T |
 |
| Q |
301 |
ttattcttctctc |
313 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
4962101 |
ttatttttctctc |
4962113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University