View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15828_low_17 (Length: 296)
Name: NF15828_low_17
Description: NF15828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15828_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 264
Target Start/End: Complemental strand, 8738990 - 8738741
Alignment:
| Q |
16 |
aaccgaattttaaaactatgcttagaagtttcatactcgcacttcaccccactcaacatacacattgcaccctcaacataatatatatggtgttgcaact |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8738990 |
aaccgaattttaaaactatgcttagatgtttcatactcgcacttcaccccactcaacatacacattgcaccctcaacataatatatatggtgttgcaact |
8738891 |
T |
 |
| Q |
116 |
aacacaatagaaccccaacaaattcaagaccaaaaatcat-ttcccttcattttaatatcctttcaccagaatcatcacccacatggcttttactaccta |
214 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| | ||||| || |
|
|
| T |
8738890 |
aacacaataaaaccccaacagattcaagaccaaaaatcataatcccttcattttaatatcctttcaccacaatcatcacccacatggataacactacgta |
8738791 |
T |
 |
| Q |
215 |
ttggatgtggtggattttatgcatgattcacatacttccactattcatag |
264 |
Q |
| |
|
|||||| |||||| | ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
8738790 |
ttggatatggtgggtcttaggcataattcacatacttccactattcatag |
8738741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University