View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15828_low_19 (Length: 248)
Name: NF15828_low_19
Description: NF15828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15828_low_19 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0036 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 90329 - 90545
Alignment:
| Q |
18 |
ggttgtagggacgttaaacttgaaataatgattttgttgtctcgtaagtacaatttttatggtaaaggatacaataacatttgatatgttagagcacggg |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
90329 |
ggttgtagggacgttaaacttcaaataatgattttgttgtctcgtaagtacaatttttatggtaaaggatacaacaacatttgatatgttagagcacggg |
90428 |
T |
|
| Q |
118 |
tttgaaggcgtaattctttctccacttgatgtgtgtaagtattgtgctaggatcttcgaaacaaaacaaaaacacatgagtttttgttctaggatcttgc |
217 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
90429 |
ttcgaaggcgtaattctttctccacttgatgcgtgtaagtattgtgctaggatcttcgaaacaaaacaaaaacaca--------------acgatcttgc |
90514 |
T |
|
| Q |
218 |
ttttcaagtgtaattgctgagtttgtaaaat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
90515 |
ttttcaagtgtaattgctgagtttgtaaaat |
90545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University