View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583-INSERTION-2 (Length: 261)
Name: NF1583-INSERTION-2
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583-INSERTION-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 37032362 - 37032195
Alignment:
| Q |
19 |
aaaatgtgagaaaaatgttaatatgatttgatggttttatgaggatggatggaccgttataggaatccaaaatgttaatgagggaaatgattgttaatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37032362 |
aaaatgtgagaaaaatgttaatatgatttgatggttttatgaggatggatggaccgttataggaatccaaaatgttaatgagggaaatgattgttaatga |
37032263 |
T |
|
| Q |
119 |
aattgaataatggaagtgaggtaaggaaatatagccgttgggttgagatcttgttgtaaaggacttga |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37032262 |
aattgaataatggaagtgaggtaaggaaatatagccgttgggttgagatcttgttgtaaaggacttga |
37032195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 217 - 261
Target Start/End: Complemental strand, 37032164 - 37032120
Alignment:
| Q |
217 |
ggctgtattggcattttgactaggcaacaacgcatggcatgtgga |
261 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
37032164 |
ggctgtattggtattttgactaggcaacaaggcatggcatgtgga |
37032120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University