View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_high_27 (Length: 286)
Name: NF15831_high_27
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 13 - 271
Target Start/End: Original strand, 42903466 - 42903724
Alignment:
| Q |
13 |
gaacctgtgaaggtgaggaaggtttgatgatgaccatgaaatgctgcaaatcccaaatattaagggagtaagcagcagacataagcaattgtggtggtcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42903466 |
gaacctgtgaaggtgaggaaggtttgatgatgaccatgaaatgctgcaaatcccaaatattaagggagtaagcagcagacataagcaattgtggtggtcc |
42903565 |
T |
|
| Q |
113 |
ctttgaagcccttagaggcattgctgccacatacacttcctctctgcctcttaccattcttcttgtctttgatacaagtgattccatttctatgtcactc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42903566 |
ctttgaagcccttagaggcattgctgccacatacacttcctctctgcctcttaccattcttcttgtctttgatacaagtgattccatttttatgtcactc |
42903665 |
T |
|
| Q |
213 |
aacaaacaaactatatttatccattcctacttttgtaagagaaactaatggttcaaatt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42903666 |
aacaaacaaactatatttatccattcctacttttgtaagagaaactaatggttcaaatt |
42903724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 107 - 271
Target Start/End: Original strand, 42908538 - 42908707
Alignment:
| Q |
107 |
tggtccctttgaagcccttagaggcattgctgccacatacacttcctctctgcctctt-----accattcttcttgtctttgatacaagtgattccattt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42908538 |
tggtccctttgaagcccttagaggcattgctgccacatacacttcctctctgcctcttatcttaccattcttcttgtctttgatacaagtgattccattt |
42908637 |
T |
|
| Q |
202 |
ctatgtcactcaacaaacaaactatatttatccattcctacttttgtaagagaaactaatggttcaaatt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42908638 |
ctatgtcactcaacaaacaaactatatttatccattcctacttttgtaagagaaactaatggttcaaatt |
42908707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University