View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_high_29 (Length: 285)
Name: NF15831_high_29
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 50 - 225
Target Start/End: Complemental strand, 29972023 - 29971849
Alignment:
| Q |
50 |
gagagtacaatacctaaatatgtatgtataagttggtagtgaagagtgaagatcgtggaaagaaagtagaactcaaaagtgatttgtgagtgttgaagat |
149 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29972023 |
gagagtacaataccaaaatatgtatgtataagttggtagtgaagagtggagatcgtggaaagaaagtagaactcaaaagtgatttgtgagtgttgaagat |
29971924 |
T |
|
| Q |
150 |
atcatagtaattaggaggtggtgatgatgatggcgttttagttttggaagaaagattcaaagaaaggaaaagtgac |
225 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29971923 |
ttcatagtaattaggaggtggtgatg-tgatggtgttttagttttggaagaaagatgcaaagaaaggaaaagtgac |
29971849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University