View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_high_30 (Length: 284)
Name: NF15831_high_30
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 51761989 - 51761739
Alignment:
| Q |
18 |
tttgccactcaaacgttcccatgcgaagatgttttaactcgttcaacgtttggtttaactgaagaaccgagtctgaaatttgagtaacgcagtccctcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51761989 |
tttgccactcaaacgttcccatgcgaagatgttttaactcgttcaacgtttggtttaactgaagaaccgagtctgaaatttgagtaacgcagtccctcaa |
51761890 |
T |
|
| Q |
118 |
agcaactcgagttctagaagtggttgtggaccctgctaccatattggattttagggttttcttgaggtaaacggaaagggtgagagtgtgagtgatactg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51761889 |
agcaactcgagttctagaagtggttgtggaccctgctaccatattggattttagggttttcttgaggtaaacggaaagggtgagagtgtgagtgatactg |
51761790 |
T |
|
| Q |
218 |
gctttgacggaggcttgagctaggtctaatggctttgttgtgagccctact |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51761789 |
gctttgacggaggcttgagctaggtctaatggctttgttgtgagacctact |
51761739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University