View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_high_32 (Length: 283)
Name: NF15831_high_32
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 6 - 267
Target Start/End: Complemental strand, 5929519 - 5929258
Alignment:
| Q |
6 |
agaagcaaaggcacttcacgtgttgggatgaggttgcaatctatagcaatttatgtcatgaggatgctgattttttatttatttacttttgtaaattcct |
105 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5929519 |
agaagcatatgcacttcacgtgttgggatgaggttgcaatctatagcaatttatgtcatgaggatgctgattttttatttatttacttttgtaaattcct |
5929420 |
T |
 |
| Q |
106 |
ttgttagattcaatcgaagaagataatttatgtctgaatttgtctccttataatttcatcactagagattgtttgttttctccatttttatttaaatttc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
5929419 |
ttgttagattcaatcgaagaagataatttatgtctgaatttgtctccttataatttcatcactagagattgtttgttttctccattttttttaaaatttc |
5929320 |
T |
 |
| Q |
206 |
tgattgtatagctcctattttgattaatgtgattttgatatatacctacctacggttgctag |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5929319 |
tgattgtatagctcctattttgattaatgtgattttgatatatacctacctacggttgctag |
5929258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University