View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_high_36 (Length: 257)
Name: NF15831_high_36
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_high_36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 66 - 257
Target Start/End: Complemental strand, 51762200 - 51762009
Alignment:
| Q |
66 |
cagttattggaattggagtgaggcttatgattcatgctttccccaagacgattgatcaagtagagagcgttacttataaacatagatgcatcggtaactt |
165 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51762200 |
cagttattggaattggagtgaggcttttgattcatgctttccccaagacgattgatcaagtagagagcgttacttataaacatagatgcatcggtaactt |
51762101 |
T |
 |
| Q |
166 |
ttcttttcacctccaacttcaccttcttttcagcatcacttctgttcaaaccgttaatacaagagttaccgttggtaaaagcagtgctggcc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51762100 |
ttcttttcacctccaacttcaccttcttttcagcatcgcttctgttcaaaccgttaatacaagagttaccgttggtaaaagcagtgctggcc |
51762009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University