View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_high_37 (Length: 256)
Name: NF15831_high_37
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 7368515 - 7368752
Alignment:
| Q |
4 |
tgatcccacttaatgagataagactttattgttgttgttgtagacttggccgttctcatataaatgttattaaattagtaatgcagccgttataaaatac |
103 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7368515 |
tgatcccacctaatgagataagactttattgttgttgttgtagacttggcctttctcatataaatgttattaaattagtaatgcagccgttataaaatac |
7368614 |
T |
|
| Q |
104 |
aatatgtttcatcaataaaaatttgcccgttttgtgtaatttttgttgcctaggtaaacccattctaatccttttgaagttattcatgctgatttatggg |
203 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7368615 |
agtatgtttcatcaa-aaaaatttgcccgttttgtgtaatgtttgttgcctaggtaaacccattctaatccttttgaagttattcatgctgatttatggg |
7368713 |
T |
|
| Q |
204 |
gtccttcacccctgccctcttcaagtttctacaactatt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7368714 |
gtccttcacccctgccctcttcaagtttctaaaactatt |
7368752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University