View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_high_38 (Length: 252)
Name: NF15831_high_38
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_high_38 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 84 - 252
Target Start/End: Original strand, 28805263 - 28805430
Alignment:
| Q |
84 |
cccgaattgaaaacgggtcgaaattgtggtaaagttgttatttttatcgaactttatgtcctttttagaagaaggggtttcttagtttatcaagagtggg |
183 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
28805263 |
cccgatttgaaaacgggtcgaaattgtggtaaagttgttatttttatcgaactttatgacctttttagaa-aaggggttttttagtttatcaagagtggg |
28805361 |
T |
 |
| Q |
184 |
agagaaattagaattgaaaattgaacatgggaattttttgtaatggagcgaagagagaatcaaactcca |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28805362 |
agagaaattagaattgaaaattgaacatgggaattttttgtaatggagcgaagagagaatcaaactcca |
28805430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University