View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_high_40 (Length: 250)
Name: NF15831_high_40
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_high_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 28805711 - 28805475
Alignment:
| Q |
17 |
tcatgttaaagtattatctcttccaatgtgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattgggaaagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28805711 |
tcatgttaaagtattatctcttccaatgcgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattggcaaagaa |
28805612 |
T |
 |
| Q |
117 |
agaacacaaaccttgaggataaattcctttgagaaaaacaacagaagtaatagcaacttccaaaaattcaaccaaaacccgacctattttccctgcaaca |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28805611 |
agaacacaaaccttgaggataaatccctttaagaaaaacaacagaggtaatagcaacttccaaaaattcaaccaaaacccgacctatttgccctgcaaca |
28805512 |
T |
 |
| Q |
217 |
tgaat---cattcttaattagtactaaaacacaataa |
250 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
28805511 |
ttaataaacattcttaattagtactaaaacacaataa |
28805475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University