View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_high_48 (Length: 218)
Name: NF15831_high_48
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 10457268 - 10457079
Alignment:
| Q |
13 |
aagaactaaaagttcatattataagatttttacgacgagtgacattgttttattaaggagtgctataattgtcttgtgtcttagggataaaattttgaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10457268 |
aagaactaaaagttcatattataagatttttaccacgagtgacattgttttattaatgagtgccataattgtcttgtgtcttagggataaaattttgaga |
10457169 |
T |
 |
| Q |
113 |
gatgtcatgaaggagacaaccatgatggttgtgtgggaaaggcaggagttattgtatatggccaggttgttggattttgatggagtttaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10457168 |
gatgtcatgaaggagacaaccatgatggttgtgtgggaaaggcaggagttattgtataaggccaggttgttggattttgatggagtttaa |
10457079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 80 - 117
Target Start/End: Complemental strand, 12936860 - 12936823
Alignment:
| Q |
80 |
attgtcttgtgtcttagggataaaattttgagagatgt |
117 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
12936860 |
attgtcttgtgccttagggataaagttttgagagatgt |
12936823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University