View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_low_29 (Length: 321)
Name: NF15831_low_29
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 17 - 173
Target Start/End: Complemental strand, 8793040 - 8792884
Alignment:
| Q |
17 |
atgcaattttcaatctaattccctgcaaacaatccttgtcaaactgaccaaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8793040 |
atgcaattttcaatctaattccctgcaaacaatccttgtcaaactgaccaaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgca |
8792941 |
T |
|
| Q |
117 |
atggcttatgcaacacgattctttgagaaggaatggtgaagcaaaaggtcttctctg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8792940 |
atggcttatgcaacacgattctttgagaaggaatggtgaagcaaaaggtcttctctg |
8792884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University