View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_low_31 (Length: 297)
Name: NF15831_low_31
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_low_31 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 179 - 297
Target Start/End: Complemental strand, 1727133 - 1727015
Alignment:
| Q |
179 |
ttcatccttaatattaaaattatttgtttgaagataccgattaatcccttaaatagatctcaaaacattataatgagaaacttaaatctcttattcattc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1727133 |
ttcatccttaatattaaaattatttgtttgaagataccgattaatcccttaaatagatctcaaaacattataatgagaaacttaaatctcttattcattc |
1727034 |
T |
|
| Q |
279 |
acttgatagtttgatctcc |
297 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1727033 |
acttgatagtttgatctcc |
1727015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 31 - 151
Target Start/End: Complemental strand, 1727281 - 1727161
Alignment:
| Q |
31 |
aattttcgtgagtgtagctcagttgatagaaagttgaagtatgtagtggttggtattcaaacaccatattccttacttatttacccttaagagttgaatt |
130 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1727281 |
aattttcgtgagtgtagctgagttgacagaaagttgaagtatgtagtggttggtatgcaaacaccatattccttacttatttacccttaagagttgaatt |
1727182 |
T |
|
| Q |
131 |
ttaatcactatgttatttgac |
151 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
1727181 |
ttaatcactaagttatttgac |
1727161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University