View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_low_35 (Length: 288)
Name: NF15831_low_35
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 57 - 153
Target Start/End: Original strand, 29972103 - 29972199
Alignment:
| Q |
57 |
gctcaatggattttacatgttctttttgttaaaaccatttcttgtcatctttcgtggaataaagttgatttagattctcaatcattagtgtgttcaa |
153 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29972103 |
gctcaacggattttacatgttctttttgttaatactatttcttgtcatctttcgtggaataaagttgatttagattctcaatcattagtgtgttcaa |
29972199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 29972266 - 29972317
Alignment:
| Q |
222 |
tccttgaatttggcagaaattgctctgtaccatcgttattttggcaaaagct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29972266 |
tccttgaatttggcagaaattgctctgtaccatcgttattttggcaaaagct |
29972317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University