View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_low_37 (Length: 285)
Name: NF15831_low_37
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 123 - 270
Target Start/End: Complemental strand, 8019513 - 8019366
Alignment:
| Q |
123 |
aggttttaactaattgcatatgattatgaaagttgttagtccttaacaattgtatgattttaggctgatatcactggtctggtatatgcacaaagtgttg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||| ||||||||||||||||| |
|
|
| T |
8019513 |
aggttttaactaattgcatatgattatgaaagttgttagtccttaacgattgtatgattttaggctaatatcactagtctggcatatgcacaaagtgttg |
8019414 |
T |
|
| Q |
223 |
tcgaaacttgtagcaaccagattgaagttgattgtcgatcgttaaagg |
270 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8019413 |
tcgaaagttgtagcaaccagattgaagttgattgtcgatcgttaaagg |
8019366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 75 - 130
Target Start/End: Original strand, 12217255 - 12217309
Alignment:
| Q |
75 |
aacttgttccacaaactatccaggtagttagttttaactaactgtaataggtttta |
130 |
Q |
| |
|
|||||||||||||| |||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
12217255 |
aacttgttccacaagttatctag-tagttagttgtaactaactgtaataggtttta |
12217309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University