View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_low_44 (Length: 266)
Name: NF15831_low_44
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 36738022 - 36737772
Alignment:
| Q |
1 |
acctcttgttgctgctgaaggttgtcacagtaaatgtgattcttcttctgttgctgatgatgaagatgaagattgtgttatcatttcttcttcagctcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36738022 |
acctcttgttgctgctgaaggttgtcacagtaaatgtgattcttcttctgttgcggatgatgaagatgaagattgtgttatcatttcttcttcagctcgg |
36737923 |
T |
|
| Q |
101 |
aaacctttaaacattgatctcaatttcccccctccaccaaattttaatgatgatgaagagattcgcgccactaccttgtgcctctcacttcccgctgcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36737922 |
aaacctttaaacattgatctcaatttcccccctccaccaaattttaatgatgatgaagagattcgcgccactaccttgtgcctctcacttcccgctgcta |
36737823 |
T |
|
| Q |
201 |
nnnnnnngccaatgaagaccaatctcattccatttgttcttgaagagaatta |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36737822 |
-ccccccgccaatgaagaccaatctcattccatttgttcttgaagagaatta |
36737772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 37 - 193
Target Start/End: Complemental strand, 36735071 - 36734915
Alignment:
| Q |
37 |
tgattcttcttctgttgct---gatgatgaagatgaagattgtgttatcatttcttcttcagctcggaaacctttaaacattgatctcaatttcccccct |
133 |
Q |
| |
|
|||| |||||||||||| | |||||||| || |||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
36735071 |
tgatgcttcttctgttgatgtggatgatgatgaagaagattgtgttatca---cttcttcatttcggaagcctttaaacattgatctcaatttccctcct |
36734975 |
T |
|
| Q |
134 |
ccaccaaattttaatgatgatgaagagattcgcgccactaccttgtgcctctcacttccc |
193 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
36734974 |
ccaccaaatttcaatgatgatgaagagattcgcgccactaccttgcgcctatcacttccc |
36734915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University