View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_low_52 (Length: 240)
Name: NF15831_low_52
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 21 - 225
Target Start/End: Original strand, 31799271 - 31799485
Alignment:
| Q |
21 |
ttcgttacattttgttttaagtaggggagcttaatacagtgattgatgttgttagttggaactt----ctggtcatgagttctagttgtggaatcaattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31799271 |
ttcgttacattttgttttaagtaggggagcttaatacagtgattgatgttgttagttgtaactttgatctggtcatgagttctagttgtggaatcaattt |
31799370 |
T |
|
| Q |
117 |
tcaacaagatgtatggtaagagatgtcaacgatatgtatgtgcaatggcactccgaccctt------ctctggatcccaccttgacgggagcactatagc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
31799371 |
tcaacaagatgtatggtaagagatgtcaacgatatgtatgtgcaatggcactccgacccttctctgactctggatcccgccttgacgggagcactatagc |
31799470 |
T |
|
| Q |
211 |
actatatgccctttg |
225 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31799471 |
actatatgccctttg |
31799485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 114
Target Start/End: Original strand, 31790780 - 31790864
Alignment:
| Q |
29 |
attttgttttaagtaggggagcttaatacagtgattgatgttgttagttggaacttctggtcatgagttctagttgtggaatcaat |
114 |
Q |
| |
|
||||||||||| |||||| ||||| |||| |||||||||||||||||||| |||| ||||| | |||| |||| |||||||||| |
|
|
| T |
31790780 |
attttgttttacgtaggg-agcttgatactgtgattgatgttgttagttgtaactaaaggtcacgggttccagttctggaatcaat |
31790864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University