View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_low_53 (Length: 240)
Name: NF15831_low_53
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 4918542 - 4918774
Alignment:
| Q |
1 |
atgttaatgtatttagttacggtgttatcttggtcgtatctcaaaatgcattagatgacatggtttacattttcttaagttgaccggtatctcgttagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
4918542 |
atgttaatgtatttagttacggtgttatcttggtcgtatctcaaaatgcattagatgatatgttttacattttctaaagttgaccggtagctcgtcagtg |
4918641 |
T |
 |
| Q |
101 |
acttagagcgatatcataagagatatttaggtcaaaatgttaatgtatctggttctcggctgcttgaggattgaaattatgtgtgctgtgtctgtgtatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||| |
|
|
| T |
4918642 |
acttagagcgatatcataagagatatttaggtcaaaatgttaatgtatctggttctcggctgcttgaggattggaattatatgcgctgtgtctgtgtatt |
4918741 |
T |
 |
| Q |
201 |
tctgttctggtagcttgttttcggcctttgcta |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4918742 |
tctgttctggtagcttgttttcggcctttgcta |
4918774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 148
Target Start/End: Original strand, 4918515 - 4918553
Alignment:
| Q |
110 |
gatatcataagagatatttaggtcaaaatgttaatgtat |
148 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
4918515 |
gatattataagagatatgtaggtcaaaatgttaatgtat |
4918553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University