View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15831_low_60 (Length: 216)
Name: NF15831_low_60
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15831_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 38998579 - 38998390
Alignment:
| Q |
13 |
tgttgttggttagttacagagtttgttaccttacgttactcttgcagccgctgatatagcttatactatgttgttcatcacagtgagtaaccaatcaaag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38998579 |
tgttgttggttagttacagagtttgttaccttacgttactcttgcagccgctgatatagcttatactatgttgttcatcacagtgagtaaccaatcaaag |
38998480 |
T |
 |
| Q |
113 |
acaccaaatgacgatgacggaactgagacaacatttcaatttcagctctaaattccgcaatcccctgcagcaatcgcggattcccccttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38998479 |
acaccaaatgacgatgacggaactgagacaacatttcaatttcagctctaaattccgcaatcccctgcagcaatcgcggattcccccttt |
38998390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 100 - 200
Target Start/End: Original strand, 41048929 - 41049029
Alignment:
| Q |
100 |
taaccaatcaaagacaccaaatgacgatgacggaactgagacaacatttcaatttcagctctaaattccgcaatcccctgcagcaatcgcggattccccc |
199 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||| | | ||||||||||||| |
|
|
| T |
41048929 |
taaccaatcaaggacaccaaatgacgatgacggaactgagacaacatttcaatttcagttctaaattcagcaatcccttgctgggaccgcggattccccc |
41049028 |
T |
 |
| Q |
200 |
t |
200 |
Q |
| |
|
| |
|
|
| T |
41049029 |
t |
41049029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 181
Target Start/End: Original strand, 41041463 - 41041537
Alignment:
| Q |
107 |
tcaaagacaccaaatgacgatgacggaactgagacaacatttcaatttcagctctaaattccgcaatcccctgca |
181 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||||||||||||||||||| ||| |||||| ||||||||||||| |
|
|
| T |
41041463 |
tcaaagacacctgatgccgatggtggaactgagacaacatttcaatttcaactcgaaattcagcaatcccctgca |
41041537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 157
Target Start/End: Original strand, 22901739 - 22901772
Alignment:
| Q |
124 |
cgatgacggaactgagacaacatttcaatttcag |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
22901739 |
cgatgacggaactgagacaacatttcaatttcag |
22901772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 157
Target Start/End: Original strand, 22953407 - 22953440
Alignment:
| Q |
124 |
cgatgacggaactgagacaacatttcaatttcag |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
22953407 |
cgatgacggaactgagacaacatttcaatttcag |
22953440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University