View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15833_high_14 (Length: 243)
Name: NF15833_high_14
Description: NF15833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15833_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 26926031 - 26926258
Alignment:
| Q |
1 |
atttaatggttcaattattgaaatatatagcaacatggccctttttattgttttacaagtgtacgtgggcatttaattttgtggataannnnnnnn-aac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26926031 |
atttaatggttcaattattgaaatatatagcagcatggccctttttattgttttacaagtgtacgtgggcatttaattttgtggataatttttttttaac |
26926130 |
T |
 |
| Q |
100 |
cttgcttttcgtatacttgtgttttaatttctgtggggtgaattatgtgtgaattggatgttatcaaatcatataattttatttgcttcatagaaaaaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26926131 |
cttgcttttcgtatacttgtgttttaatttctgtggggtgaattatgtgtgaattggatgttatcaaatcatataattttatttgcttcatagaaaaaga |
26926230 |
T |
 |
| Q |
200 |
aaagaaaacaatatatataactacatat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26926231 |
aaagaaaacaatatatataactacatat |
26926258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University