View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15833_high_3 (Length: 348)
Name: NF15833_high_3
Description: NF15833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15833_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 102 - 331
Target Start/End: Original strand, 21476248 - 21476476
Alignment:
| Q |
102 |
cttgttcaaggtaaagagccctagaacttttgttgtcatagaagatgtcaaacaaacctattccaagtaagttccgcccttgaatcatgttcaatgatgg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
21476248 |
cttgttcaaggtaaagagccctagaacttttgttgtcatagaagatgtcaaacaa-cctattccaagcaagttccacccttgaatcatgttcaatgatgg |
21476346 |
T |
|
| Q |
202 |
tattgagaaggtcattagaaatcgtgccgaatatccattgtaacacgacggcatcgaggcaaagccatagttcaggatcggtgtctttcagtgagggaga |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21476347 |
tattgagaaggtcattagaaatcgtgccgtatatccattgtaacacgacggcattgaggcgaagccagagttcaggatcggtgtctttcagtgagggaga |
21476446 |
T |
|
| Q |
302 |
gtttattgttatcgtacttggttgtaaaaa |
331 |
Q |
| |
|
||||||||||||| |||||||||||||||| |
|
|
| T |
21476447 |
gtttattgttatcatacttggttgtaaaaa |
21476476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 170
Target Start/End: Original strand, 21476203 - 21476233
Alignment:
| Q |
140 |
tagaagatgtcaaacaaacctattccaagta |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21476203 |
tagaagatgtcaaacaaacctattccaagta |
21476233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 304 - 341
Target Start/End: Complemental strand, 27513618 - 27513581
Alignment:
| Q |
304 |
ttattgttatcgtacttggttgtaaaaagttcatctca |
341 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27513618 |
ttattgttatcatacttggttgtaaaaagttcatctca |
27513581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University