View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15833_low_20 (Length: 201)
Name: NF15833_low_20
Description: NF15833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15833_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 13 - 181
Target Start/End: Complemental strand, 51156062 - 51155894
Alignment:
| Q |
13 |
gattatacttagttatagcttgtttctccctagtgaatgatgcaacctgcatttggaaaatgagactcatttctatattatgtaataacaaaataaagca |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
51156062 |
gattatatttagttatagcttgtttctccccagtgaatgatgcaacctacattcagaaaatgggactcatttctatattatgtaataacaaaataaaaca |
51155963 |
T |
|
| Q |
113 |
aagtctcaatgttattttttgctaatgtacttatagttcggatgcaacctattgtctgctcaactacac |
181 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
51155962 |
aagtttcaatgttattttttgctaatgtacttacagttcggatggaacctattgtctgctcaactacac |
51155894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 13 - 73
Target Start/End: Original strand, 29938026 - 29938086
Alignment:
| Q |
13 |
gattatacttagttatagcttgtttctccctagtgaatgatgcaacctgcatttggaaaat |
73 |
Q |
| |
|
||||||| || ||| ||||||||||||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
29938026 |
gattatattttgttgtagcttgtttctccccagtgaatgatgcaacctgtatttgaaaaat |
29938086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 65
Target Start/End: Complemental strand, 51144922 - 51144870
Alignment:
| Q |
13 |
gattatacttagttatagcttgtttctccctagtgaatgatgcaacctgcatt |
65 |
Q |
| |
|
||||||| |||| | ||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
51144922 |
gattataattagctgtagcttgtttctccccggtgaacgatgcaacctgcatt |
51144870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 13 - 63
Target Start/End: Complemental strand, 36285281 - 36285231
Alignment:
| Q |
13 |
gattatacttagttatagcttgtttctccctagtgaatgatgcaacctgca |
63 |
Q |
| |
|
||||||| |||| ||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
36285281 |
gattatatttagctatagcttgcttctccccagtgaatgatgcaacctgca |
36285231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University