View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15834_high_11 (Length: 269)
Name: NF15834_high_11
Description: NF15834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15834_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 42216347 - 42216108
Alignment:
| Q |
18 |
gttacagatagcttacttattttgatttgtactttgtagggactatctattaatacctttacccccgagaaaaatatgtatccactgactagtggacgtc |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42216347 |
gttacaaatagcttacttattttgatttgtactttgtagggactatctattaatacctttacccccgagaaaaatatgtatccactgactagtggaagtc |
42216248 |
T |
 |
| Q |
118 |
ttgctgctaaccttagtggagatgaatatggaaatcctaggtatggttattattcttatatcattaacccttaattgtttgttatatatattttttattt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42216247 |
ttgctgctaaccttagtggagatgaatatggaaatcctaggtatggttattattcttatatcattaacccttaattgtttgctatatatattttttattt |
42216148 |
T |
 |
| Q |
218 |
cttgataataagattacaaaggtttgaggaaatgatgatg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42216147 |
cttgataataagattacaaaggtttgaggaaatgatgatg |
42216108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University