View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15834_low_18 (Length: 242)
Name: NF15834_low_18
Description: NF15834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15834_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 1020563 - 1020329
Alignment:
| Q |
1 |
cagtttctactgtgtttggttggacctagccaatatcatgctgtcaatttacttttttctcctcactttt---------aaatcatttaattttgagaac |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1020563 |
cagtttctactgtgtttggttggacctagccaatatcatgctgtcaatttacttttttctcctcacttttgtgactgttaaatcatttaattttgagaac |
1020464 |
T |
 |
| Q |
92 |
aagagtgaacaatgcaatttatgaattgagcaaaacaacaacattgaacatatagatagttatactcagatgtgccaagactttctgtcttcaaataaac |
191 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1020463 |
aagagtgaacaatgcaatttatgaattcagcaaaacaacaacattgaacatatagatagttatactcagatgtgccaagactttctgtcttcaaataaac |
1020364 |
T |
 |
| Q |
192 |
aatgtaaaatgaatctcccaagagtttattaaaag |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1020363 |
aatgtaaaatgaatctcccaagagtttattaaaag |
1020329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University