View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15835_low_3 (Length: 296)
Name: NF15835_low_3
Description: NF15835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15835_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 5 - 283
Target Start/End: Original strand, 29333768 - 29334033
Alignment:
| Q |
5 |
ggcggcggtggcggagatgtgacggaggcggaagtggaggttcggtggcggtttttggagggaaaagtgaatttcagtttcattctgttatggcggcgtt |
104 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29333768 |
ggcggcggtggtggagaggtgacggaggcggaagtggaggttcggtggcggtttttggagggaaaagtgaatttcagtttcattctgttatggcggcgtt |
29333867 |
T |
 |
| Q |
105 |
ccacgtcagcttttctgttgaattttagaagaaagacagtggcagtattgtaatttgtgaagaagggtttttctcttattatatagggttaatgggggtt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29333868 |
ccacgtcagcttttctgttgaattttagaagaaagacagtggcagtattgtaatttgtgaagaagggtttttctcttattatata----------gggtt |
29333957 |
T |
 |
| Q |
205 |
aatgtagtggcagtaaaaacccgttactcagttctgtctggtcaaagttgttatttgcgactagttacttgagctcttc |
283 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
29333958 |
aatgtagtggcagtaaaaacccgt---tcagttctgtctagtcaaagttgttatttgcgggtggttacttgagctcttc |
29334033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University