View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15837_high_12 (Length: 243)
Name: NF15837_high_12
Description: NF15837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15837_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 53 - 237
Target Start/End: Complemental strand, 3864831 - 3864647
Alignment:
| Q |
53 |
aattgtgcatagtcagaatctggagactaaaattgcatcataaggtcattgagatgaaccaaacatattgatattgatgcttgatttgttataattgaac |
152 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| |
|
|
| T |
3864831 |
aattgtgcatagtcaaaatctggagactaaaattgcatcataaggtcattgagatgaaccaaacatagtgatattgatacttgatttgtcataattgaac |
3864732 |
T |
 |
| Q |
153 |
ttcttcaggttactacacttttccaaggctatcccgaccttcttgacgagtttactcatttccttcaaaaaactatttcttctca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3864731 |
atcttcaggttactacacttttccaaggctatcccgaccttcttgacgagtttactcatttccttcaaaaaactatttcttctca |
3864647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University