View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15837_low_10 (Length: 319)
Name: NF15837_low_10
Description: NF15837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15837_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 13 - 305
Target Start/End: Complemental strand, 45900932 - 45900640
Alignment:
| Q |
13 |
gagatgaatcagaaattgatcctttcacattcttgaagtgatttcgacggttaaactgctttggatgttgaaggttgagtctatcaagtatccacagttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45900932 |
gagatgaatcagaaattgatcctttcacattcttgaagtgatttcgacagttaaactgctttggatgttgaaggttgagtctatcaagtatccacagttt |
45900833 |
T |
 |
| Q |
113 |
gaaaccacgaaattttcgacagaaagaagagcttccaacacttgctactgaatgaaagctgcttgatgcaacctgcaacaattaacaaaagaagatcaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45900832 |
gaaaccacgaaattttcgacagaaagaagagcttccaacacttgctactgaatgaaagctgcttgatgcaacctgcaacaattaacaaaagaagattaag |
45900733 |
T |
 |
| Q |
213 |
cgtctggttcgtattagaggctacaaatttctaagggggaacnnnnnnntacggtaatagtgttgaaatttgagcatggatgtgttgatcttg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45900732 |
cgtctggttcgtattagaggctacaaatttctaaggggaaacaaaaaaatacggtaatattgttgaaatttgagcatggatgtgttgatcttg |
45900640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University