View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15837_low_11 (Length: 314)
Name: NF15837_low_11
Description: NF15837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15837_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 36339256 - 36339510
Alignment:
| Q |
1 |
catttatgagattaggtcttgcattgaagaactgcaacatgtagcatcagtggaaatcgtgatatagaatcatgttgtaattgtttagtggtccccttct |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36339256 |
catttatgagattaggttttgcattgaagaactgcaacatgtagcatcagtggaaatcgtgatatagaatcatgttgtaattgtttagtggtccccttct |
36339355 |
T |
|
| Q |
101 |
gtaggaggtgtatagttttcaaaggaactgtagtttgtatttgtacatttaatttgcttcttcaaaactcgttgtatcaatagacattctttacttccaa |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
36339356 |
gtaggaggggtatagttttcaaaggaactgtagtttgtatttgtacatttaatttgcttcttcaaaactcgttgcat--------------------caa |
36339435 |
T |
|
| Q |
201 |
tggagttggtaaagattttgatttctacttacatctcccttccctgtagttagttatacaatataatcaaaggaa |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36339436 |
tggagttggtaaagattttgatttctacttacatctcccttccctgtagttagttatacaatataatcaaaggaa |
36339510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 267 - 298
Target Start/End: Original strand, 36341330 - 36341361
Alignment:
| Q |
267 |
tcaaaggaatatgatttttacttttaagtttt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36341330 |
tcaaaggaatatgatttttacttttaagtttt |
36341361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University