View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15837_low_15 (Length: 240)
Name: NF15837_low_15
Description: NF15837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15837_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 23945063 - 23945265
Alignment:
| Q |
18 |
aagaacggtaacaactttaatgtgggtaacggtaaaaacgaaaaatcaggaataatgatggaggagtttccgttcaaaactgatatcttgggtattaatg |
117 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23945063 |
aagaacgataacaacattaatgtgggtaacggtaaaaacgaaaaatcaggaataatgatggaggagattccgttcaaaactgatatcttgggtattaatg |
23945162 |
T |
|
| Q |
118 |
gtgaaccggattctttgcatggtgagtggattaaagtggaaagnnnnnnncgagtcaataaggctgggtcacgcattgctggtgcagacatgaaaggtac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23945163 |
gtgaaccggattctttgcatggtgagtggattaaagtggaaagaaaaaaacgagtcaataaggttggttcacgcattgctggtgcagacatgaaaggtac |
23945262 |
T |
|
| Q |
218 |
atc |
220 |
Q |
| |
|
||| |
|
|
| T |
23945263 |
atc |
23945265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University