View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15838_low_12 (Length: 227)
Name: NF15838_low_12
Description: NF15838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15838_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 33601148 - 33600951
Alignment:
| Q |
13 |
gaatattgatatcattatcatcataatatcatcttagtattattaattatcttttacagttcagtgattattcagtcagaagctcagtgatcgggttgaa |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33601148 |
gaatatttatatcattatcatcataatatcatcttagtattattaattatcttttacagttcagtgattattcagtcagaagctcagtgatcgggttgaa |
33601049 |
T |
|
| Q |
113 |
tattaactgttcattaacctttcttttcctttttctcacctatatatatgaaccctatgtctgtgtacattattggacagtgataatactcactattc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33601048 |
tattaactgttcattaacctttcttttcctttttctcacctatatatatgacccctatgtctgtgtacattattggacagtgataatactcactattc |
33600951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University