View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15839_high_8 (Length: 317)
Name: NF15839_high_8
Description: NF15839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15839_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 84 - 301
Target Start/End: Complemental strand, 13265966 - 13265747
Alignment:
| Q |
84 |
tgagaacatttgctcattgtcgaactcaattcaattctctaccccaatgtgcatcctctccaactaatcaaacat--gtactagtatgtaacaaaataac |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13265966 |
tgagaacatttgctcattgtcgaactcaattcaattctctaccccaatgtgcattctctccaactaatcaaacatatgtactagtatgtaacaaaataaa |
13265867 |
T |
|
| Q |
182 |
gttggaagttggaaccactcaatttcagaagacccatataatcatgttgggcaatcggttaactatatgcggttgagaaagaagaagataaacttgcaga |
281 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13265866 |
gttggaagttggaaccactcaatttgagaagacacatataatcatgttgggcaatcggttaactatatgcggttgagaaagaagaagataaacttgcaga |
13265767 |
T |
|
| Q |
282 |
gtttatatgaattaaagatt |
301 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13265766 |
gtttatatgaattaaagatt |
13265747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 13266020 - 13265974
Alignment:
| Q |
21 |
agagagaaaattgttacaaaa-ttgtgttgtacaaatatcatttcta |
66 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
13266020 |
agagagaaaattgttgcaaaaattgtgttgtacaaatatcatttcta |
13265974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University