View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15839_low_10 (Length: 317)

Name: NF15839_low_10
Description: NF15839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15839_low_10
NF15839_low_10
[»] chr2 (2 HSPs)
chr2 (84-301)||(13265747-13265966)
chr2 (21-66)||(13265974-13266020)


Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 84 - 301
Target Start/End: Complemental strand, 13265966 - 13265747
Alignment:
84 tgagaacatttgctcattgtcgaactcaattcaattctctaccccaatgtgcatcctctccaactaatcaaacat--gtactagtatgtaacaaaataac 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||  ||||||||||||||||||||||     
13265966 tgagaacatttgctcattgtcgaactcaattcaattctctaccccaatgtgcattctctccaactaatcaaacatatgtactagtatgtaacaaaataaa 13265867  T
182 gttggaagttggaaccactcaatttcagaagacccatataatcatgttgggcaatcggttaactatatgcggttgagaaagaagaagataaacttgcaga 281  Q
    ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13265866 gttggaagttggaaccactcaatttgagaagacacatataatcatgttgggcaatcggttaactatatgcggttgagaaagaagaagataaacttgcaga 13265767  T
282 gtttatatgaattaaagatt 301  Q
    ||||||||||||||||||||    
13265766 gtttatatgaattaaagatt 13265747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 13266020 - 13265974
Alignment:
21 agagagaaaattgttacaaaa-ttgtgttgtacaaatatcatttcta 66  Q
    ||||||||||||||| ||||| |||||||||||||||||||||||||    
13266020 agagagaaaattgttgcaaaaattgtgttgtacaaatatcatttcta 13265974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University