View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15839_low_11 (Length: 310)
Name: NF15839_low_11
Description: NF15839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15839_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 42805122 - 42804825
Alignment:
| Q |
1 |
acttgatcaagacgaaggtgctattcagttaataggcttcccttcccacgtaagcatatgcgctgacaatggcaagaaatcaggatgccacctaaagttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42805122 |
acttgatcaagacgaaggtgctattcagttaataggcttcccttcccacgtaagcatatgcgctgacaatggcaagaaatcaggatgccacctaaagttg |
42805023 |
T |
 |
| Q |
101 |
taaacnnnnnnnttgaatgtaatttgatgggattttgaagtgaaggaaagtaaaagtgagtatgagatgcttttttcaatttggagtaagtgtcaaacct |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42805022 |
taaacaaaaaaattgaatgtaatttgatgggattttgaagtgaaggaaagtaaaagtgagtatgagatgcttttttcaatttggagtaagtgtgaaacct |
42804923 |
T |
 |
| Q |
201 |
tcctttcatggaggcttgctatgagtagaaggaagaccaagtaggataggggcaatgggaccttatagaagggccattaccattagtattttcttcga |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42804922 |
tcctttcatggaggcttgctatgagtagaaggaagaccaagtaggataggggcaatgggaccttatagaagggccattaccattagtattttcttcga |
42804825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University