View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15839_low_6 (Length: 371)
Name: NF15839_low_6
Description: NF15839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15839_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 11 - 353
Target Start/End: Original strand, 47707769 - 47708111
Alignment:
| Q |
11 |
gatgaaatctaaaagggtgttgcacaagacaaagaggttgttatttgattgtgtgagagaacttgcaaaaagtcttccagataaagattgtaagcaattc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
47707769 |
gatgaaatctaaaagggtgttgcacaagacaaagaggttgttatttgattgtgtgagagaacttacaaaaaatcttccagaaaaagattgtaagcaattc |
47707868 |
T |
 |
| Q |
111 |
atgggtgccgaaaagttggggaagatgttatgggagaggacaaaagaatggagcgaaagaggtggaaattatgagagaaatctaagtaacttgctgaatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47707869 |
atgggtgccgaaaagttggggaagatgttatgggagaggacaaaagaatggagtgaaagaggtggaaattatgagagaaatctaagtaacttgctgaatt |
47707968 |
T |
 |
| Q |
211 |
tggattacttggattcaattaatgaatggagtgaatttaagactgaggtgaaagatgttagtattgagattgctgatgcaattttggaatgtgtgatcag |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47707969 |
tggattacttggattcaattaatgaatggagtgaatttaagaccgaggtgaaagatgttagtattgagattgctgatgcaattttggaatgtgtgattag |
47708068 |
T |
 |
| Q |
311 |
ggatgaagtagtatcagatatcattgaaattttatcacgcaac |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47708069 |
ggatgaagtagtatcagatatcattgaaattttatcacacaac |
47708111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University