View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_high_36 (Length: 305)
Name: NF1583_high_36
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 197 - 291
Target Start/End: Complemental strand, 32168207 - 32168110
Alignment:
| Q |
197 |
cttgaactagtagcttcc---acaccttgcttgactcacgcacatcactaactactccatcttggtaatggtacccccaaaccaaaacacctccatct |
291 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32168207 |
cttgaactagtagcttcctccacaccttgcttgactcacgcacatcactaactactccattttggtaatggtacccccaaaccaaaacacctccatct |
32168110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 32168402 - 32168295
Alignment:
| Q |
1 |
tttctaaactttagatctctgttactctaccaactattgtgtcattttgtcaccttccaacaaagattttaacgtggt-ttttatgggtataaaagggta |
99 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
32168402 |
tttctaaaattttgatctctgttacactaccaactattgt--cattttgtcaccttccaacaaagattttaacgtggttttttttgggtataaaagggta |
32168305 |
T |
 |
| Q |
100 |
aaatcataac |
109 |
Q |
| |
|
|||||||||| |
|
|
| T |
32168304 |
aaatcataac |
32168295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University