View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_high_61 (Length: 239)
Name: NF1583_high_61
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_high_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 1253414 - 1253620
Alignment:
| Q |
15 |
agcagagaactatgcaatagaagcaactccatgatcattgttatgctctaattcccccgggaaaatattgtgcattcgagtttttgaaaaccacatcaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1253414 |
agcagagaactatgcaatagaagcaactccatgatcattgttatgctctaatccccccaggaaaatattgtgcattcgagtttttgaaaaccacatcaat |
1253513 |
T |
|
| Q |
115 |
agatgtgcaggatggtgagccaaaggcagagccatctatattggctttgtttcctcttcaataagttttgtttcatcttcgttttggactaaaaactagg |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||| |||||||||||||| |
|
|
| T |
1253514 |
agatgtggaggatggtgagccaaaggcagagccatctatattggctttgtttcctcttcaataagttttgtttcctctttggttttgactaaaaactagg |
1253613 |
T |
|
| Q |
215 |
ttttttc |
221 |
Q |
| |
|
||||||| |
|
|
| T |
1253614 |
ttttttc |
1253620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13890 times since January 2019
Visitors: 1144