View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_high_64 (Length: 235)
Name: NF1583_high_64
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_high_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 220
Target Start/End: Original strand, 32831926 - 32832139
Alignment:
| Q |
13 |
atgaaacaattaaacaaaatcataacaatacatgatgaaaaatgtttcaaagaattagtaaatgtgattaacaaaccttgactttgtcattatcctgatc |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32831926 |
atgaaacaattaaacaaaaacataacaatacatgatgaaaaatgtttcaaagaattagtaaatgtgattaacaaaccttgactttgtcattatcctgatc |
32832025 |
T |
 |
| Q |
113 |
ccaactgaaagaagcaagaggagaataactgcgtgcaggtgaaggtgagaccgtagttccggttgcaattggtgct------ggaatctgtgatgcacgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
32832026 |
ccaactgaaagaagcaagaggagaataactgcgtgcaggtgaaggtgagaccgtagttccggttgcaattggtgctggaatcggaatctgtgacgcacgt |
32832125 |
T |
 |
| Q |
207 |
gcggtagatgttgc |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32832126 |
gcggtagatgttgc |
32832139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University