View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_high_67 (Length: 227)
Name: NF1583_high_67
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_high_67 |
 |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0578 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1859 - 2079
Alignment:
| Q |
1 |
cgcggagtaaggaaggcccttcaggcagtgacaaggctgaagaagttgctgattccagtgacaaatctgaagctggtgccgattcctccatcgtcaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1859 |
cgcggagtaaggaaggcccttcaggcagtgacaaggctgaagaagttgctgattccagtgacaaatctgaagctggtgccgattcctccatcgtcaaatt |
1958 |
T |
 |
| Q |
101 |
ctgcaatccaggtttcaattcttcattacaaaatctctcatattcagctctgtccccaccttttttcttcacctcaacaacaaccaaagaaggtgttagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1959 |
ctgcaatccaggtttcaattcttcattacaaaatctctcatattcagctctgtccccaccttttttcttcacctcaacaacaaccaaagaaggtgttagc |
2058 |
T |
 |
| Q |
201 |
tcaaatatctcagcagcaata |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2059 |
tcaaatatctcagcagcaata |
2079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 4955867 - 4956087
Alignment:
| Q |
1 |
cgcggagtaaggaaggcccttcaggcagtgacaaggctgaagaagttgctgattccagtgacaaatctgaagctggtgccgattcctccatcgtcaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4955867 |
cgcggagtaaggaaggcccttcaggcagtgacaaggctgaagaagttgctgattccagtgacaaatctgaagctggtgccgattcctccatcgtcaaatt |
4955966 |
T |
 |
| Q |
101 |
ctgcaatccaggtttcaattcttcattacaaaatctctcatattcagctctgtccccaccttttttcttcacctcaacaacaaccaaagaaggtgttagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4955967 |
ctgcaatccaggtttcaattcttcattacaaaatctctcatattcagctctgtccccaccttttttcttcacctcaacaacaaccaaagaaggtgttagc |
4956066 |
T |
 |
| Q |
201 |
tcaaatatctcagcagcaata |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4956067 |
tcaaatatctcagcagcaata |
4956087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 196
Target Start/End: Complemental strand, 35828907 - 35828864
Alignment:
| Q |
153 |
tccccaccttttttcttcacctcaacaacaaccaaagaaggtgt |
196 |
Q |
| |
|
||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
35828907 |
tcccctccttttttcttcacctcaaccaccaccaaagaaggtgt |
35828864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University