View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_high_69 (Length: 226)
Name: NF1583_high_69
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_high_69 |
 | |
|
| [»] scaffold0578 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 221
Target Start/End: Complemental strand, 4955756 - 4955540
Alignment:
| Q |
6 |
aatagattgtgtatgataaaattgatgattgatcatttttcccccggatggtcccccctttagatttgctccctgaatcgagcattagattttacagtat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4955756 |
aatagattgtgtatgataaaattgatgattgatcatttttcccccggatggtcccccttttagatttgctccctgaatcgagcattagattttacagtat |
4955657 |
T |
|
| Q |
106 |
tttctatgtccaattgctatacaaagaaggctaatttaattttagctaatggtggatatttttctatgt-ttttattttggtgcattattccgtacctgt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4955656 |
tttctatgtccaattgctatacaaagaaggctaattgaattttagctaatggtggatatttttctatgttttttattttggtgcattattccgtacctgt |
4955557 |
T |
|
| Q |
205 |
acattacctttgcttct |
221 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
4955556 |
acattacttttgcttct |
4955540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 221
Target Start/End: Complemental strand, 1748 - 1531
Alignment:
| Q |
6 |
aatagattgtgtatgataaaattgatgattgatcatttttcccccggatggtcccccctttagatttgctccctgaatcgagcattagattttacagtat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1748 |
aatagattgtgtatgataaaattgatgattgatcatttttcccccggatggtcccccttttagatttgctccctgaatcgagcattagattttacagtat |
1649 |
T |
|
| Q |
106 |
tttctatgtccaattgctatacaaagaaggctaatttaattttagctaatggtggatatttttctat--gtttttattttggtgcattattccgtacctg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1648 |
tttctatgtccaattgctatacaaagaaggctaattgaattttagctaatggtggatatttttctattgttttttattttggtgcattattccgtacctg |
1549 |
T |
|
| Q |
204 |
tacattacctttgcttct |
221 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
1548 |
tacattacttttgcttct |
1531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2419 times since January 2019
Visitors: 8717