View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_low_38 (Length: 297)
Name: NF1583_low_38
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 11 - 174
Target Start/End: Complemental strand, 38026760 - 38026597
Alignment:
| Q |
11 |
catcatcacatggggggcaccataaaaaattgatatattatatagtatttatggcatgatggcggtcccttctcagtcacaattgtgagctgaattatac |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38026760 |
catcttcacatggggggcaccataaaaaattgatatattatatagtatttatggcatgatggcggtcccttctcagtcacaattgtgtgctgaattatac |
38026661 |
T |
 |
| Q |
111 |
tgaccttgcttggttggagttgtggagtagaggctccagctgggtgggagacaaacaagggcgg |
174 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38026660 |
tgaccttgcttggttggagttgtgaagtagaggctccagctgggtgggagacaaacaagggcgg |
38026597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 199 - 282
Target Start/End: Complemental strand, 38026571 - 38026488
Alignment:
| Q |
199 |
agggtatggtatggtagtcacacacaattggttattttaacccttcctttcttgtacttactctttcacatcaaccaagttttt |
282 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38026571 |
agggtatggtatggtagtcacatacaattggttattttaacccttcctttcttgtacttactctttcacatcaaccaagttttt |
38026488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University