View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_low_55 (Length: 250)
Name: NF1583_low_55
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_low_55 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 97 - 234
Target Start/End: Original strand, 4895621 - 4895758
Alignment:
| Q |
97 |
ggaggtagacacaatgggagaaagagataatgatgaaatgagaagatccaatgtaaaataaaagactcttgtttatttatttattttaagggtgaaagac |
196 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4895621 |
ggaggtagacacgatgggagaaggagagaatgatgaaatgagaagatccaatgtaaaataaaagactcttgtttatttatttattttaagggtgaaagac |
4895720 |
T |
|
| Q |
197 |
ccttattgtctaccccacaaatttgaattttaataatt |
234 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4895721 |
ccttattgtttaccccacaaatttgaattttaataatt |
4895758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21939 times since January 2019
Visitors: 1208