View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_low_59 (Length: 241)
Name: NF1583_low_59
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_low_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 152
Target Start/End: Original strand, 32838418 - 32838552
Alignment:
| Q |
18 |
ccatgaatctccggtggattggtgctctgagagctccgcgaaaggggaattttggagggagataggaaggttagaacctcacggtgaaaattgaattttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32838418 |
ccatgaatctccggtggattggtgctctgagagctccgcgaaaggggaattttggagggagataggaaggttagaacctcacggtgaaaattgaattttg |
32838517 |
T |
 |
| Q |
118 |
aaatactacaatgcaagtgaataagtaatttccct |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32838518 |
aaatactacaatgcaagtgaataagtaatttccct |
32838552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 32838578 - 32838654
Alignment:
| Q |
165 |
gttaattacgttttatatttgggtcttgataacgagtgtcttgatatactagttaagaatacaaaaatgaaaataat |
241 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||| |||||||| | | |||||||||| ||||||||||||||||||| |
|
|
| T |
32838578 |
gttaattaggttttatatttgggtcttgttaactagtgtcttaagacactagttaaggatacaaaaatgaaaataat |
32838654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University