View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_low_60 (Length: 239)
Name: NF1583_low_60
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_low_60 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 239
Target Start/End: Original strand, 10703 - 10927
Alignment:
| Q |
15 |
agaaacaacacaaaacagctcttctttaaataccatccaggaacaataccaacaaattattcatctccttcaaaataatatgacttcttccgctactagt |
114 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10703 |
agaaacaacacaaaataacccttctttaaataccatctaggaacaataccaacaaattattcatctccttcaaaataatatgacttcttccactactagt |
10802 |
T |
 |
| Q |
115 |
attgctccacaacatgctgctgccaactctgtccattcccaatctgcatccattcattccatttcatctccacaaatgggtaagcaatctgtcctttgaa |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10803 |
attgctccacaacaagctgctgccaactctgtcctttcccaatctgcatccattcattccatttcatctccacaaatgggtaagcaatctgtcctttaga |
10902 |
T |
 |
| Q |
215 |
tcatggattctggtgccacccatca |
239 |
Q |
| |
|
|||||||| | |||||||||||||| |
|
|
| T |
10903 |
tcatggatacaggtgccacccatca |
10927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University